eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	central core disease

Disease ID	160
Disease	central core disease
Definition	An inherited congenital myopathic condition characterized by weakness and hypotonia in infancy and delayed motor development. Muscle biopsy reveals a condensation of myofibrils and myofibrillar material in the central portion of each muscle fiber. (Adams et al., Principles of Neurology, 6th ed, p1452)
Synonym	cco central core dis central core disease (disorder) central core disease of muscle central core diseases central core myopathies central core myopathy central core myopathy (disorder) myopathies, central core myopathy, central core myopathy, central core [disease/finding] shy magee syndrome shy-magee syndrome syndrome, shy-magee
Orphanet	ORPHANET:597
OMIM	OMIM:117000
DOID	DOID:3529
UMLS	C0751951
MeSH	D020512
SNOMED-CT	SNOMEDCT_US_2016_09_01:43152001
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 6261 \| RYR1 \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) 6261 \| RYR1 \| CIPHER;CTD_human
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:42) 58 \| ACTA1 \| 3.33 \| DISEASES 273 \| AMPH \| 1.372 \| DISEASES 27063 \| ANKRD1 \| 2.297 \| DISEASES 444 \| ASPH \| 2.572 \| DISEASES 487 \| ATP2A1 \| 3.601 \| DISEASES 488 \| ATP2A2 \| 1.994 \| DISEASES 79886 \| CAAP1 \| 2.838 \| DISEASES 779 \| CACNA1S \| 4.61 \| DISEASES 801 \| CALM1 \| 1.72 \| DISEASES 844 \| CASQ1 \| 3.79 \| DISEASES 23607 \| CD2AP \| 2.282 \| DISEASES 1553 \| CYP2A13 \| 2.058 \| DISEASES 1572 \| CYP2F1 \| 2.706 \| DISEASES 1756 \| DMD \| 2.02 \| DISEASES 1760 \| DMPK \| 1.093 \| DISEASES 1785 \| DNM2 \| 2.227 \| DISEASES 1798 \| DPAGT1 \| 2.399 \| DISEASES 8291 \| DYSF \| 1.203 \| DISEASES 2280 \| FKBP1A \| 3.868 \| DISEASES 2281 \| FKBP1B \| 1.91 \| DISEASES 642489 \| FKBP1C \| 3.661 \| DISEASES 2318 \| FLNC \| 2.181 \| DISEASES 390594 \| KBTBD13 \| 3.79 \| DISEASES 3908 \| LAMA2 \| 2.154 \| DISEASES 4151 \| MB \| 1.123 \| DISEASES 4534 \| MTM1 \| 4.228 \| DISEASES 4625 \| MYH7 \| 3.834 \| DISEASES 4671 \| NAIP \| 1.601 \| DISEASES 4703 \| NEB \| 3.74 \| DISEASES 5339 \| PLEC \| 1.385 \| DISEASES 6261 \| RYR1 \| 8.352 \| DISEASES 6262 \| RYR2 \| 4.89 \| DISEASES 6263 \| RYR3 \| 4.147 \| DISEASES 6611 \| SMS \| 2.522 \| DISEASES 6345 \| SRL \| 2.477 \| DISEASES 8803 \| SUCLA2 \| 2.219 \| DISEASES 81493 \| SYNC \| 2.874 \| DISEASES 284612 \| SYPL2 \| 3.401 \| DISEASES 51270 \| TFDP3 \| 2.894 \| DISEASES 7169 \| TPM2 \| 2.865 \| DISEASES 7170 \| TPM3 \| 3.08 \| DISEASES 10345 \| TRDN \| 3.494 \| DISEASES
Locus	Symbol \| Locus(Total Locus:1) RYR1 \| 19q13.2

Disease ID	160
Disease	central core disease
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:4) HP:0003803 \| Type 1 muscle fiber predominance HP:0003198 \| Myopathy HP:0003798 \| Nemaline bodies HP:0001252 \| Muscular hypotonia
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:1) HP:0100595 \| Camptocormia \| 1

Disease ID	160
Disease	central core disease
Manually Symptom	UMLS \| Name(Total Manually Symptoms:2) C2364050 \| hypothermia C0700208 \| scoliosis
Text Mined Symptom	(Waiting for update.)

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:91)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs104893991	24634175	860	RUNX2	umls:C0751951	BeFree	On the basis of the structural analysis, this study further demonstrated that the p.R225Q mutation abolished DNA binding by RUNX2 and its results also suggested that other genetic and/or environmental factors could affect the CCD phenotypes.	0.017915164	2014	RUNX2	6	45438040	G	A
rs115974315	22194205	860	RUNX2	umls:C0751951	BeFree	We demonstrated that a novel mutation (c.549delC) of RUNX2 is associated with CCD in a Chinese family, adding to the repertoire of RUNX2 mutations related to CCD.	0.017915164	2011	RUNX2	6	45431988	C	T
rs118192113	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38442395	C	A
rs118192115	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38446484	G	A
rs118192116	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38451850	C	G
rs118192117	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38451846	T	C
rs118192118	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38452854	C	T
rs118192119	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38455328	G	A
rs118192120	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38483311	G	A
rs118192121	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38496910	A	C
rs118192122	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38500643	G	A
rs118192123	12810058	6261	RYR1	umls:C0751951	BeFree	The reduction of EC(50) indicates a facilitated calcium release from sarcoplasmic reticulum in the myotubes of the index patient suggesting that the RYR1 Ile2453Thr mutation is pathogenic for the malignant hyperthermia susceptibility and CCD of the two affected individuals.	0.605052927	2003	RYR1	19	38500640	T	C
rs118192123	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38500640	T	C
rs118192124	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38500636	C	T
rs118192125	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38506952	G	A
rs118192126	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38519295	A	G
rs118192127	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38527777	T	C
rs118192129	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38565320	C	A
rs118192130	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38570620	G	A
rs118192131	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38570650	T	C
rs118192132	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572163	T	A
rs118192133	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572172	G	A
rs118192134	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572182	C	T
rs118192135	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572185	G	A
rs118192136	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572184	G	A
rs118192138	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572221	T	C
rs118192139	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572224	A	C
rs118192140	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38573304	C	T
rs118192141	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38575959	A	C
rs118192142	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580057	C	T
rs118192143	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580395	C	G,T
rs118192144	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580430	A	G
rs118192146	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580449	A	G
rs118192147	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38584955	C	T
rs118192148	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38584986	G	T
rs118192148	23308296	6261	RYR1	umls:C0751951	BeFree	Here we evaluated the function of the R4892W and G4896V RyR1 mutants, both associated with central core disease (CCD) in humans, in myotubes and in adult muscle fibers.	0.605052927	2013	RYR1	19	38584986	G	T
rs118192149	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38584967	G	C
rs118192150	23308296	6261	RYR1	umls:C0751951	BeFree	Here we evaluated the function of the R4892W and G4896V RyR1 mutants, both associated with central core disease (CCD) in humans, in myotubes and in adult muscle fibers.	0.605052927	2013	RYR1	19	38584973	C	G,T
rs118192150	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38584973	C	G,T
rs118192151	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38584974	G	A,C
rs118192153	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585013	C	G,T
rs118192154	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585037	G	C
rs118192155	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585055	C	A
rs118192156	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585058	T	C
rs118192158	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585952	G	A
rs118192159	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585948	C	G,T
rs118192160	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38442361	G	A
rs118192161	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38444211	C	T
rs118192161	20978128	6261	RYR1	umls:C0751951	BeFree	Heterozygous mice expressing the human MH/central core disease RyR1 R163C mutation exhibit MH when exposed to halothane or heat stress.	0.605052927	2011	RYR1	19	38444211	C	T
rs118192162	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38455359	A	C,G
rs118192163	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38494565	G	A,C
rs118192165	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38564974	CGCCAGTTC	-
rs118192166	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38572181	A	G
rs118192167	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580004	A	G
rs118192169	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580445	TTCTACAACAAGAGCGAGGAT	-
rs118192170	21149547	6261	RYR1	umls:C0751951	BeFree	The human RYR1(I4898T) mutation is one of the most common CCD mutations.	0.605052927	2011	RYR1	19	38584989	T	C
rs118192170	12161072	6261	RYR1	umls:C0751951	BeFree	The presence of an alternate mechanism of muscle weakness in CCD is supported by the observation that muscle cells expressing a CCD mutation in the putative pore-forming segment of RyR1 (I4898T) exhibit a functional uncoupling of SR Ca(2+) release from sarcolemmal depolarization.	0.605052927	2002	RYR1	19	38584989	T	C
rs118192170	11274444	6261	RYR1	umls:C0751951	BeFree	A novel mutation in the C-terminal region of RyR1 (I4898T) accounts for an unusually severe and highly penetrant form of CCD in humans [Lynch, P. J., Tong, J., Lehane, M., Mallet, A., Giblin, L., Heffron, J. J., Vaughan, P., Zafra, G., MacLennan, D. H. & McCarthy, T. V. (1999) Proc.	0.605052927	2001	RYR1	19	38584989	T	C
rs118192170	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38584989	T	C
rs118192170	10097181	6261	RYR1	umls:C0751951	BeFree	Comparison with two other coexpressed mutant/normal channels suggests that the I4898T mutation produces one of the most abnormal RyR1 channels yet investigated, and this level of abnormality is reflected in the severe and penetrant phenotype of affected central core disease individuals.	0.605052927	1999	RYR1	19	38584989	T	C
rs118192171	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	NA	NA	NA	NA	NA
rs118192175	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38494564	C	T
rs118192176	15299003	6261	RYR1	umls:C0751951	BeFree	The functional impact on calcium release of RYR1 mutations linked to central core disease or malignant hyperthermia is different: human myotubes carrying the malignant hyperthermia-linked RYR1 mutation V2168M had a shift in their sensitivity to the RYR agonist 4-chloro-m-cresol to lower concentrations, whereas human myotubes harboring C-terminal mutations linked to central core disease exhibited reduced [Ca2+]i increase in response to 4-chloro-m-cresol, caffeine, and KCl.	0.605052927	2004	RYR1	19	38494579	G	A
rs118192178	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38500898	C	G,T
rs118192179	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38579995	T	C
rs118192180	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580090	C	A,T
rs118192181	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580439	C	T
rs118192183	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38584992	G	A
rs118192184	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585036	A	G
rs121918592	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38448712	G	A,C
rs121918594	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38500655	G	A
rs137932199	21674524	6261	RYR1	umls:C0751951	UNIPROT	Patients with muscle symptoms in adulthood, who had features compatible with CCD/MmD, underwent clinical, histological, and genetic (RYR1 and SEPN1 genes) evaluations.	0.605052927	2011	RYR1	19	38519292	G	A,T
rs141646642	21674524	6261	RYR1	umls:C0751951	UNIPROT	Patients with muscle symptoms in adulthood, who had features compatible with CCD/MmD, underwent clinical, histological, and genetic (RYR1 and SEPN1 genes) evaluations.	0.605052927	2011	RYR1	19	38496278	C	G,T
rs143987857	18253926	6261	RYR1	umls:C0751951	UNIPROT	Null mutations causing depletion of the type 1 ryanodine receptor (RYR1) are commonly associated with recessive structural congenital myopathies with cores.	0.605052927	2008	RYR1	19	38525492	G	A
rs146876145	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38586140	C	T
rs147136339	20681998	6261	RYR1	umls:C0751951	UNIPROT	Novel missense mutations and unexpected multiple changes of RYR1 gene in 75 malignant hyperthermia families.	0.605052927	2011	RYR1	19	38543551	A	G
rs193922772	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38457546	G	A,T
rs193922816	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38500642	C	T
rs193922820	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38502527	G	C
rs193922893	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38585075	GTCATC	-
rs28933396	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38499997	G	A,T
rs28933396	12059893	6261	RYR1	umls:C0751951	UNIPROT	Mutation screening in the ryanodine receptor 1 gene (RYR1) in patients susceptible to malignant hyperthermia who show definite IVCT results: identification of three novel mutations.	0.605052927	2002	RYR1	19	38499997	G	A,T
rs28933396	7849712	6261	RYR1	umls:C0751951	BeFree	This mutation is adjacent to the previously identified Arg2434His mutation reported in a CCD/MH family and indicates that there may be a second region in the RYR1 gene where MHS/CCD mutations cluster.	0.605052927	1994	RYR1	19	38499997	G	A,T
rs28933996	11575529	6261	RYR1	umls:C0751951	UNIPROT	North American malignant hyperthermia population: screening of the ryanodine receptor gene and identification of novel mutations.	0.605052927	2001	NA	NA	NA	NA	NA
rs28933999	12208234	6261	RYR1	umls:C0751951	UNIPROT	These results indicate that the C-terminal region of RYR1 represents an additional hot spot for mutations in patients with MH, similar to what has been reported for patients with CCD.	0.605052927	2002	NA	NA	NA	NA	NA
rs63749869	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38580440	G	A
rs772494345	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38561329	G	T
rs794727460	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38473687	G	-
rs794727683	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38500839	CAAAGATGTCAGC	-
rs794727982	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38561442	G	A
rs794727984	NA	6261	RYR1	umls:C0751951	CLINVAR	NA	0.605052927	NA	RYR1	19	38564958	G	T

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:2)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0003803	Type 1 muscle fiber predominance	MP:0013237	abnormal skeletal muscle regeneration	anomaly in the ability to repair skeletal muscle after injury or disease
HP:0001252	Muscular hypotonia	MP:0004144	hypotonia	decreased muscle tension resulting in limpness of the muscles in the resting state, not to be confused with weakness

Mapped by homologous gene(Total Items:4)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0001252	Muscular hypotonia	MP:3000003	abnormal Ebner's gland morphology	any structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0003803	Type 1 muscle fiber predominance	MP:0020214	susceptible to malignant hyperthermia	increased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine
HP:0003798	Nemaline bodies	MP:0020240	increased skeletal muscle cell apoptosis	increase in the number of skeletal muscle cells undergoing programmed cell death
HP:0003198	Myopathy	MP:0020280	increased creatine kinase level	increased level of the enzyme that catalyzes the reversible transfer of creatine to phosphocreatine

Disease ID	160
Disease	central core disease
Case	(Waiting for update.)